Content

HD Genetic Education

The language used on this webpage was provided with permission from the Huntington’s Disease Youth Organization (www.HDYO.org). HD Genetics made appropriate edits and updates to content in January 2023 and published Jan 10, 2023. The original content can be found on HDYO’s pages (What is Huntington’s Disease, Genetic Testing and Being At-Risk).

The content  below is meant as educational content and not medical advice. Please reach out to the HD Genetics team or your healthcare professional if you have questions or concerns.

About Huntington’s Disease

Download

Huntington’s Disease (HD) is known as a rare ‘genetic neurodegenerative disorder’. The word genetic means that this disease is passed down from one generation to the next. Neuro relates to the brain. Degenerative means something that gradually gets worse over time. Disorder is another word for disease.

So, when people describe HD, they are saying it is a disease passed down from a parent to a child, which affects the brain, and gradually gets worse over time.

First, let’s go over some basics, starting with DNA. DNA is the name of the chemical that our genes are made from. The letters ‘DNA’ stand for Deoxyribonucleic Acid (catchy, isn’t it?). Not surprisingly, nobody really uses the full name – DNA is a lot easier to say and remember.

DNA is what we inherit from our parents. Our parents inherited their DNA from their parents, and so on. Our DNA decides who we are, what we look like and how we grow. Things like our hair color, skin color, eye color, height, gender, and even aspects of our personality are all decided by our DNA.

We call the instructions that are stored in the DNA “genes”. We have a lot of genes – around 23,000 genes to be exact in the cells of our bodies. Each gene is a set of instructions – like a cooking recipe. A gene tells the cell how to make something called a protein. Proteins are like little machines in our cells that do all the important stuff – from making chemical reactions happen to passing messages from one cell to another.

Genes are strung together like sausages and packaged into things called chromosomes. There are 46 chromosomes in total. 23 come from one parent and 23 come from the other. Each cell in our bodies contains a copy of all 46 chromosomes.


Genetic changes: The Huntington’s Disease Gene

Sometimes changes (called ‘mutations’ or ‘variants’ by researchers) happen within chromosomes or genes. These changes can alter the way the body works and cause genetic disorders. Sometimes these changes have no effect. Other times, even a tiny change in the gene can cause a dramatic change in the protein. Imagine a recipe that told the chef to cook a pie for 400 minutes instead of 40 and you’ll get an idea of how small changes in our genes can cause big problems.

In 1993, a team of researchers discovered the gene responsible for Huntington’s disease on chromosome 4. They found that one part of the gene repeated itself over and over again, like a stutter or when you hold a key down too long on a computer keeeeeeeeeeeeeeeeeeeeeeeeeyboard. This repeat is what causes the development of Huntington’s disease and is known as a ‘CAG repeat’.


What is a ‘ CAG repeat ‘ ?!

Basically, DNA is made up of four bases, which are known as: 

  1. Adenine ( A )
  2. Cytosine ( C )
  3. Guanine ( G ) 
  4. Thymine ( T )

These bases are the code behind all our DNA and genes. Each gene has a different code and we use the short letter abbreviations for simplicity. So the four DNA bases are known as A, C, G, and T, and if someone was to write out a gene code it would look something like this: AAGTCCTGACTGGGACCTTGAGA CCTAG.

If a gene is like a recipe, then the bases are like the alphabet of letters that make up the instructions in the recipe. Genes just use a very simple alphabet with four letters to choose from. But spelling is just as important.

The gene that causes Huntington’s disease contains a section where the bases C, A and G are repeated many times – the ‘CAG repeat’. Most copies of the gene contain between 10 and 20 repeats, but sometimes the repeat gets longer and that’s when it starts to cause trouble.


CAG Repeats in Huntington’s Disease

Every single person on the planet has two copies of the gene involved with Huntington’s disease, whether they’re at risk for Huntington’s disease or not. One copy was inherited from each parent. Both copies of this gene contain a CAG repeat.

What causes the development of the disease is the number of times the CAG is repeated. Put simply, people who develop Huntington’s disease have longer CAG repeats than those that don’t. Only one of the copies has to be expanded in order to cause problems. To make things easier to follow, we will split the CAG repeats into four different ranges. 

CAG repeats are split into four categories. If a person has 26 or less CAG repeats then that is what is called a ‘negative’ result – meaning that person will not get Huntington’s disease and they are not at risk of passing the disease onto any biological children.

Someone who has 40 CAG repeats or more will definitely develop symptoms of Huntington’s disease in their lifetime (although it is not possible to say when symptoms will start) and the risk to any of their children is 50% each.

Someone who has between 27-35 CAG repeats will almost certainly not develop Huntington’s disease, but there will still be a very small risk of that person passing on the disease to any of their children (the risk is about 5%).

Someone who has between 36-39 repeats would be in what is called the ‘grey area’ or “reduced penetrance” zone. Technically people in this range do have the expanded gene, but people in this range may develop symptoms of Huntington’s disease at an older age than people with 40 or more CAG repeats. All biological children of people with 36-39 CAG repeats are at risk of Huntington’s disease.

26 or less CAG repeats
Will not develop Huntington’s disease and children not at risk.

27-35 CAG repeats
Almost certainly will not develop Huntington’s disease but small risk to children.

36-39 CAG repeats
May develop symptoms at an older age. 50% risk to each child.

40 or more CAG repeats
Will develop symptoms in their lifetime. 50% risk to each child.

The risk of passing this expanded gene onto any child is 50%. CAG repeats can expand when passed to children. 

If you have been tested it is always important to be clear about the result of your predictive test. If you have any questions or do not understand your results, reach out to the HD Genetics team or speak with your healthcare professional who is knowledgeable about HD.


Inheriting the ‘Expanded’ Huntington’s Disease Gene

Bottom line: if the Huntington gene has too many CAG repeats, it causes Huntington’s disease. Now let’s look at how people inherit that expanded gene and how Huntington’s disease can be passed on through families.


The 50% Risk

People get Huntington’s disease by inheriting the expanded gene from a parent. Because we inherit one copy of each chromosome from each parent, we end up with two copies of each gene – one from mom and the other from dad.

So, a person with Huntington’s disease has two copies of the Huntington gene, one of which is expanded (with a lot of CAG repeats) and another which is normal.

A person without Huntington’s disease also has two copies of the Huntington’s disease gene, but both of theirs are in a normal lower range.

So a child with one parent who has Huntington’s disease has one normal gene from the unaffected parent, but could have inherited either the expanded gene or the normal one from the parent with Huntington’s disease.

That makes the risk of having inherited the expanded gene 50%.

Technically there are four possible outcomes with regards to the genes being passed on. Two of these outcomes end up with the child having the expanded gene and the other two do not – so the chances are 50%. But to make things easier to understand you can rule out the parent who does not have Huntington’s disease, and just focus on whether the child inherits the expanded gene or the normal one from the parent with Huntington’s disease. Either way, it is still a 50% risk.

Whether a person inherits the expanded or normal gene is purely down to chance, and that’s why you may hear people compare the risk for Huntington’s disease to the flip of a coin. Each individual has their own 50% risk too, so it is like everybody having their own coin to flip with regard to their own risk.


The 25% Probability

For some, the risk is not always as straightforward as 50%. For example, if a child’s grandparent has Huntington’s disease, but the child’s at-risk parent has NOT been tested, then the child technically has a 25% probability of having inherited the gene.

That’s because we don’t know whether the parent has the expanded gene or not. If the parent did have the expanded gene, then the risk to the child would be 50%.

If the parent doesn’t have the expanded gene, then the risk drops from 25% to 0% – meaning there is no risk at all to the child. It really all depends on which genes the parent inherited. Until we know, the child is at 25% risk.

This is a tough situation for many people who want to undergo genetic testing while their at-risk parent does not want testing for themselves. If the child decides to undergo genetic testing and gets a positive result, it provides enough information to know that their at-risk parent is also positive for HD. In this situation it’s a great opportunity to speak with a genetic counselor who can help you think through your situation.

Autosomal Dominant

If a person has one expanded gene and one normal gene, why does the expanded gene take control and cause Huntington’s disease? Why doesn’t the normal gene fight back? Well, look no further than the term ‘autosomal dominant’. Unfortunately Huntington’s disease is what is known as an ‘autosomal dominant disorder’, which means that even though only one copy of the two genes is expanded, it is still enough to cause the disease. In other words, it dominates the other normal gene. That’s why it only takes one expanded gene to cause the disease, rather than two.

Being At-Risk for Huntington’s Disease

Being at risk of Huntington’s disease can have a big impact on a person’s life. The next section will aim to cover the feelings experienced by people with regards to being at-risk, while providing advice and support on how to overcome these worries. First, let’s look into a bit more of the science of being at-risk.


What does being ‘at-risk’ mean?

Being ‘at-risk’ basically means that a person has a chance of inheriting Huntington’s disease from their affected parent. This is because Huntington’s disease is a genetic condition, so anyone who has a biological parent with Huntington’s disease is at-risk of inheriting the condition themselves. The only exceptions are those that were born through procedures like PGD/IVF and other processes. 


50/50 Odds

There are many different types of worries that people have about the 50/50 risk associated with Huntington’s disease. One common feeling among those at-risk is that, although they know the risk is 50%, it simply does not feel that way to them. Many people feel like the odds are stacked in favor of inheriting the expanded gene that causes Huntington’s disease, rather than the normal gene that does not.

‘Fifty percent, no matter how often I get told “is a perfectly evenly balanced probability”, seems a lot larger than it should be! I mean the 50% chance of having the (expanded) gene outweighs the 50% chance of not having it – it looms larger in my head at least. My math teacher would kill me for saying that as it makes no logical sense.’ Luke

It is very common and understandable to feel this way. The worry can tend to feel larger than a 50/50 risk should, and the mind has a way of focusing on the worrying aspect of that 50/50 risk, rather than the more positive outlook that there is also a 50% chance of not having Huntington’s disease.

Feeling that the risk is more than 50% is not always a bad thing either, some people at-risk actually prefer to think and live as if they are going to get Huntington’s disease at some point in their lives. People see it as a good way to cope – expecting the worst and hoping for the best. Also, it can be seen as a good approach to living life because it can sometimes encourage people to do more with their time.

‘Even though I am at-risk, I have always lived as if I’m gene positive and had already planned everything in my life to be done before I was 40, because I assumed I was going to get sick after that.’ Paula (who eventually tested negative)


50/50: Siblings – “One of us must have it”

An extremely common feeling or misunderstanding among siblings at-risk for Huntington’s disease is that one of them must have it. This is absolutely not the case: each individual has a separate 50/50 chance of inheriting Huntington’s disease. For example, if there are 10 siblings in a family who all have a 50% risk, it does not mean that 5 of them must have the expanded Huntington’s disease gene. Because each individual has their own 50/50 risk, there is absolutely no way to predict how many out of those 10 siblings have or haven’t inherited an expanded gene.

For some, this issue is a misunderstanding of the science for being at-risk, but for others it is more about the mind playing tricks again. Many people who know and understand that each individual has their own 50/50 risk, find it doesn’t stop them from thinking that siblings’ risks must be linked.

For example, in a family with a brother and sister at-risk, if the brother decides to be tested and receives a negative result (meaning he won’t get Huntington’s disease) the sister may start to think that she must have inherited it instead.

As mentioned above, this is simply not the case. It’s very important to remember that each person has their own 50/50 risk.


“You look just like your parent…”

Another common worry for people at-risk is that they share the same characteristics as their family member (usually the parent or grandparent) who has Huntington’s disease. This is down to the fact that the disease is genetic and people may feel that if they have the same hair color, eye color or other physical features as their affected family member then they may have inherited the gene for Huntington’s disease from them too.

‘My mom has Huntington’s disease and people used to say how much I looked like her and that I had my mom’s hair. I used to smile but inside it would really worry me because, as much as I love her, I did not want to inherit everything from my mom!’ Tiffany

Someone at risk could look, sound and behave exactly like their affected parent in every way – it doesn’t matter: that person’s chance of having inherited the gene that causes Huntington’s disease is still 50/50.


The Family ‘Script’

Some people live in a family where there may appear to be a pattern to how the disease is inherited. For example, it may be the case that in the last few generations, in one particular family, they may have had only the women in the family inherit the disease, or the eldest siblings etc. This can lead people to believe that the pattern is certain to continue in exactly the same way for their generation of the family.

‘I’m scared because it always seems to be the youngest sibling that gets Huntington’s disease in my family. My mom was the youngest of her siblings, and so was my grandpa. I’m scared because I’m the youngest sibling in my generation so I could get it too.’ Leanne

This is an understandable conclusion and worry for anyone, but it’s simply not true. It is just a coincidence that the family tree has worked out that way. Remember, each individual has a 50/50 risk.


Predictive Testing

Another issue for those at-risk is the decision to undergo genetic testing or not. Since 1993, people at risk for Huntington’s disease have been able to be tested to see whether they have the expanded gene that causes Huntington’s disease.

The decision to test is down to the individual who is at-risk, and them alone. But making that decision either way is not often an easy one. Only about one in five people at risk decide to be tested according to a 2017 study. The majority either don’t want to test or remain undecided.

Spending time thinking about whether to test or not may generate tension and worries for people at risk. Some worry about whether to test at all, or when the right time to test is; others about how they might react, whether they would be discriminated against, and how the family might take the news if they decided to be tested.

‘I’ve known I was at-risk for a few years now and I agonize over the decision of whether to test or not. It is such a difficult choice to make and there seems to be so much to consider when testing. It does cause quite a lot of worry, on top of the worry I [already] feel because of being at-risk.’ Jacob

There are many issues associated with testing for those that are at-risk. 


Symptom Hunting

Perhaps the most common and biggest worry for those people at-risk comes in the form of ‘symptom hunting’. Symptom hunting is when people at risk for Huntington’s disease search for symptoms of the disease in themselves.

Usually this happens when someone trips or falls, is clumsy, or knocks something over. People immediately worry that this incident may be the involuntary movements associated with Huntington’s disease. Many people will have seen their family member(s) with Huntington’s disease drop things, break items or lose their balance. Because of this, when they trip or break something, it is hard for them not to think and worry about the similarities between the two instances.

‘Every time I dropped a cup, or my fingers moved on the steering wheel, or I tripped on a step I’d be thinking “oh my gosh, [these] are early signs of Huntington’s disease”. I didn’t know what it felt like to think, “I’m having a bad day” or, “That step got in the way!”, it was a classic case of symptom hunting and it was quite a regular worry for me.’ Naomi

Almost everybody at risk does this – even some people who have had a negative genetic test (meaning they won’t get Huntington’s disease) still do it.

‘I used to be symptom hunting all the time and I would end up getting really worried. But now I’ve almost grown tired of worrying all the time about something I have no control over. I figure that I cannot possibly tell if I have symptoms or not so I just think to myself “why bother to worry about it”.’ Jeff

It can be almost impossible to avoid the worry of symptom hunting, but attempting to take a similar approach to symptom hunting as Jeff does may help. Symptom hunting tends to come and go, and your mood can play an important role in how you cope. If you can find the ability to shrug or laugh off any trips, falls, spillages or breakages then you will spend far less time worrying about them in general.

Here’s the thing: most people who are getting symptoms of Huntington’s disease are actually not aware of changes in their movements or balance, because the disease causes loss of insight, referred to as anosognosia. So, if you’re worrying about noticing symptoms in yourself, it may actually be unlikely that you are.


Being At-Risk: The Impact on Life

Being at risk—and the worry that comes with it—can also have an impact on people’s personal lives, including their education, career or relationships. This is a video clip of a young person, Raphael, talking about how he feels being at-risk ‘blocks’ him career-wise. Raphael doesn’t say whether this is due to his own feelings and worries about being at-risk or the views of others that he may work with, but this is not an unusual feeling for somebody at risk to have.

‘I feel like I have no time to build a career, I feel like I must achieve everything straight away before I get old and perhaps become ill. But then I end up feeling that I can’t achieve my goals in that timeframe and what’s the point? ‘ Emma

Another point that Raphael makes is that he does not want to ‘waste time’ because he may get ill when he is older. This is another classic example of the impact being at-risk has on the way people think and plan their lives. That sense of ‘wasting time’ is something that people at-risk may be able to relate to regarding their own lives. For example, some people may feel they are wasting time doing the job they currently do or the university course they are enrolled in. Anybody can feel this way, but being at-risk can really make it seem vital to not waste time and as a result people tend to second guess the decisions they make in their lives.

‘I was working at a job which was completely boring, I hated it. I used to look at the clock in the office and think to myself “I am wasting my life away here, I may get ill and still be stuck in this place”.’ George

The impact of being at-risk on people’s lives can be very difficult to cope with. The impact, although difficult, does not have to be a negative one. Rather than letting the fact you are at-risk hold you back or bring you down, it can be used to encourage yourself to achieve what you want to achieve in life – whatever that may be.

‘I really did not like the job I was in; I told myself that I needed to change things. So I started doing a part-time degree in a course that actually interested me. Eventually I left my job, got my degree, went traveling around North America for a few months, came home and started a new job that I am far happier doing. I feel like I’m living the way I want to live now and I don’t look at the clock in the office as much as I used to!’ George (again)

George used the fact he was at-risk to encourage himself to achieve the things he wanted to achieve. The point is that being at-risk does not always have to be a ‘dark cloud’ – it can be the encouragement to go on in life and achieve the things you want to achieve.


Finding Support

Being at risk can cause a lot of worry and concern for people. Because of this, it is important that people at risk have support. As a family, sometimes the best way to cope with Huntington’s disease is to discuss it freely and openly, so that people feel comfortable and know that they can talk about any worries they have with the family.

If open dialogue about Huntington’s disease is missing in the family, people can end up feeling very isolated with their concerns. Often, just being able to talk about worries can be a great relief.

If you don’t feel that you can talk to your family about Huntington’s disease or you don’t want to talk to them, then you may find support through your local advocacy organization or online support groups like HDYO’s Facebook Group or the many other online forums. There, you will find many people going through similar concerns who will be able to share experiences. Talking to others in similar situations can provide great support. You can also reach out to HD Genetics for help getting connected to proper resources.


Staying Informed, Getting Involved

Learning about Huntington’s disease is a great way to help come to terms with being at risk. By finding the HD Genetics website, you’ve already taken a big step, because knowledge is power. Another thing a lot of people find helpful is to remember that scientists around the world are working 24 hours a day to develop treatments and determine how to stop or slow the course of Huntington’s disease. If research knowledge gives you hope you can always stay up to date by visiting www.HDBuzz.net or connecting with our team at HD Genetics who can share resources and provide an overview of all that is happening in HD research today and how you could even get involved to help researchers.

There is no right or wrong way to spend your life if you’re at risk, and it’s perfectly OK to not want to think about Huntington’s disease at all. But getting involved has proven to be beneficial for many people. The more people that do get involved in fundraising and research, the closer effective treatments will become.


Accepting the Risk of Huntington’s Disease

No-one wants to be at risk for a disease, but facing that risk and accepting it will help you move forward in the long run. It is never easy accepting such a risk, and it will take some time and effort to come to terms with it. But through educating yourself on the disease, finding a support network that is there for you, and understanding that this risk does not stop you from achieving the things you want to achieve in life, you can learn to accept — and maybe even embrace — the risk of Huntington’s disease.

Genetic Testing & Counseling

In 1993, scientists discovered exactly where the gene which causes Huntington’s disease is located in our DNA. Because of this people are now able to have what is called a ‘predictive genetic test’. It is called a predictive test because the test can be taken by people at risk of Huntington’s disease who currently show no symptoms and want to learn whether they will develop the condition in the future. The result of this test will usually be able to tell a person whether they have the expanded gene or not. This is done by sharing the amount of CAG repeats the individual has in their DNA.


The Science Behind Testing for Huntington’s Disease

You may hear people say that they ‘have the gene’ when referring to themselves as having Huntington’s disease. The truth is that all humans have the gene that may cause Huntington’s disease – even those who never develop Huntington’s disease. It would be more accurate to say “I have the gene mutation that causes Huntington’s disease”. So if we all have the gene, why do some develop Huntington’s disease when others do not? The difference is people who develop symptoms of Huntington’s disease have a larger expansion of the gene than normal. In simple terms, the gene becomes too long.


What is this Gene Expansion?

Without getting too scientific, there is a section in the gene, which repeats itself over and over again. This is known as a ‘CAG repeat’. Each individual has a different amount of repeats. However, people with Huntington’s disease tend to have more repeats than usual, which means that the gene expands more than it should. This expansion can lead to Huntington’s disease.

The reason we are explaining CAG repeats is because of their relevance to predictive testing for Huntington’s disease. When people at-risk for Huntington’s disease have a predictive test, that person’s DNA is sent to a genetics laboratory where special machines will count how many CAG repeats that a person has in the gene specific to Huntington’s disease. Once they know how many repeats a person has, they can determine the likelihood that an at-risk individual will get the disease or not. 

As a reminder of what was shared above:

26 or less CAG repeats
Will not develop Huntington’s disease and children not at risk

27-35 CAG repeats
Almost certainly will not develop Huntington’s disease but small risk to children.

36-39 CAG repeats
May develop symptoms at an older age. 50% risk to each child.

40 or more CAG repeats
Will develop symptoms in their lifetime. 50% risk to each child.


Genetic Counseling and the Testing Process

Genetic testing is ultimately about finding out your CAG repeat – and this can be done with a DNA sample. Saliva and blood are the most commonly used forms of DNA for genetic testing. Taking a predictive genetic test in order to find out whether you will get Huntington’s disease or not is a huge decision to make in one’s life, and can be an enormous thing to deal with emotionally. 

What if a person gets a positive result? How might they cope?

Genetic counseling can help individuals prepare for predictive testing for Huntington’s disease by helping them to consider how testing may affect them and the people close to them, and whether now is a good time in their life to pursue predictive testing. How long the counseling takes depends on you and your counselor and your particular personal circumstances. At HD Genetics, the length of our process can vary. The whole process can be as short as 4-weeks or as long as the individual may want or need, based on their requests and conversation with our genetic counselor.

In that time many things are discussed, as one genetic counselor explains:

‘It’s very much a two way process whereby you can explore the option of a predictive test and what it entails, including the possible test outcomes. There may be discussions around alternatives to testing, possible impact on other family members, and the question of timing of the test. It can vary how ready an individual feels to proceed with a test – and that’s fine – we’d want to take it at a pace that feels right for the individual.’ Tiffany, Genetic counselor

In order to be tested you normally have to be 18+ years old. Although, if you are under 18 you can still speak with a genetic counselor about what a test involves and any other issues you may have with regard to Huntington’s disease.

If at any stage during the genetic counseling process you change your mind and do not want to be tested, you can stop the process. Some people even get all the way to providing their DNA and decide now is not the right time for them to hear their results. They then ask for their results to be kept under lock and key until they feel ready to collect them. 


It is Your Choice

It is very important to remember that testing is a personal choice – a choice only you have the right to make. Some people in your life may tell you to test or not to test but it is not up to them. It is entirely your decision and you should only get tested if you are sure this is what you want.

‘I haven’t set a date on when I’ll test, but I want it to be on my terms and not on other people’s terms. I’ve encountered people in my life who have pressured me to test and not test. After countless words from people, I finally realized it is not up to them and I have to feel it in my heart when the time is right.’ Stacey

There is no right or wrong answer when it comes to making a decision about genetic testing. People are different! We all live different lives and we all make different decisions. Some will choose to test; others will not – there are perfectly good reasons for deciding one way or the other. Although it is your decision, you may also wish to discuss your feelings with those closest to you (like partners, siblings or children) for whom the result will also have a bearing. Ultimately, it is your choice.


Insurance Factors and Considerations

If you decide that you want to be tested and feel now is the right time for you, then it is important to be prepared. One of the many practical things you may wish to do before you get your test result is to look through different types of insurance options like life insurance or long-term care insurance. If you already have insurance before you test, then you do not need to disclose your test results to insurers and your results will not affect your existing insurance. Issues with insurance vary depending on where you live and which company you use. If you do not have insurance and want to get covered before you test then you can talk with your genetic counselor or your national Huntington’s disease organization about this issue. 

People don’t often think about things like insurance; it is usually something people look into when they are buying a house or starting a family etc. 

‘I got tested when I was 19 and although I knew about insurance, I was too young to really understand how important it was to have insurance in place. So I just pushed it to one side and focused on the testing process. Now, some years later, I do wish that I had taken out insurance.’ Joel

Whether to acquire insurance is your choice – it is not a requirement. You do not need to be insured in order to test.

Testing Anonymously, Costs for Genetic Test, Medical Insurance

One of the many questions people ask their genetic counselor is if they should use a fake name (also known as a pseudonym) on their genetic test. Using a pseudonym has positives and negatives and ends up being the choice of each individual. People typically want to use a fake name so there is no record of Huntington’s disease tied to their real name that could negatively impact their medical health insurance or their employment. Many healthcare systems do not allow individuals to use a fake name, so make sure to ask this up-front. At HD Genetics, we allow individuals to use a fake name after they talk through the options with our genetic counselor. 

The potential negative of using a fake name future financial cost of having to test again under your legal name to establish care for HD with a medical provider. At some point, it will likely be a good thing to have Huntington’s disease in your medical record so that your insurance will help cover medication and treatment options. You may need proof of your genetic status under your legal name, which would require you to undergo testing again.

The cost of genetic testing varies depending on where you undergo genetic testing. Some clinics will make it mandatory for you to see a genetic counselor and other healthcare professionals which can increase the cost. A study took data from 777 tests conducted at HD Centers of Excellence in the USA and reported the average cost to undergo testing was $1,157. Depending on your preference and your carrier, sometimes insurance will help offset these costs. Also, many HD Centers have financial aid to help offset the costs. At HD Genetics, our cost is $750 total for counseling and testing. If you can’t afford the $750 cost, we have a partnership with Help4HD that offers individuals financial aid so that funds are never a barrier to get a test for an individual. The financial aid is meant to be an easy to access fund to make sure individuals receive the proper genetic services without any barriers.

Using your medical insurance to cover your genetic test is totally up to you. Figuring out if that’s something you want to do is a great conversation to have with a genetic counselor. At HD Genetics you can speak with our genetic counselor at no-cost at any time before testing (you don’t even have to tell us your real name).

Emotional Aspects of the Testing Process

Aside from the practical ways to be prepared, testing can be a very emotional process from start to finish. From making the decision to test, going to your genetic counseling sessions, providing a DNA sample, and receiving your result – each stage provides its own emotional hurdles to overcome.

Dealing with the emotions of testing can be incredibly challenging for anyone. When you take into account that the whole process can take months, it can become very difficult for a person to maintain their calm throughout. You may have many ups and downs during the process – Try not to be alarmed by this. It is quite normal for your thoughts & emotions to fluctuate during this time. Keep discussing your emotions with the genetic counselor – that is what they are there for! You could also seek advice from others who have gone through the testing process for Huntington’s disease and have faced the same emotions and difficulties.


The Waiting Period

There is a part of the testing process that has not been highlighted yet, ‘the waiting period’. This period covers the time between providing your DNA sample for analysis and receiving your test results.This period typically ranges a couple weeks. At HD Genetics the average waiting period is three weeks after you submit your DNA sample to the laboratory. This can be an incredibly difficult time for a person in the testing process; those weeks can often feel like months! People can become very anxious during the waiting period and it is important to try and stay busy during this time.

‘When I say that the weeks between [providing my DNA sample] and getting my results were agonizing, I mean it. I believe those were the hardest weeks of my life. Every day, it was a battle of thoughts going through my head, making it hard to sleep. How do you deal with such an internal battle? You are literally driving yourself crazy… an emotional wreck getting no sleep because your mind is racing, and scared that at the moment you don’t know what your future holds.’ Laura

If you feel it would be helpful to speak to your genetic counselor during this period, call them (they will not know your result at this stage). Or again, seek advice and support from those who have experienced the waiting period themselves.


Preparing for Your Results

Preparing for results is another challenging aspect of the testing process. Many people tend to develop a ‘feeling’ one way or the other about whether they are going to test positive or negative. Obviously you can’t guess or ‘feel’ what result you are going to get, and these guesses can end up causing more shock when you receive your results (should you get the result you weren’t expecting). Rather than trying to guess one way or the other, it can often be good to remind yourself that until you test, you are ‘at-risk’.

‘I spent the entire testing process feeling that I was going to test negative. When I got my results, they were positive… It was pretty tough to take. It took me at least a few months to move on from there.’ Joe

However, preparing for your results can be useful. During your counseling you may be asked to think about how your life may be affected if you test positive or negative. This is a good exercise because it allows you to really think and plan how you will react to your results, whatever they may be.


Finding Support

Support during the testing process is important. You are entitled and encouraged to have a family member or a friend to your counseling sessions and your results appointment, and it is highly encouraged that you do so. When some people decide to get tested, they may be hesitant to tell their family/friends and decide to face the process alone. People’s reasons for not telling their family about such a huge life decision are usually because they do not want to put their loved ones through any extra stress, worry or pain. People often feel like they are burdening their family by adding the testing process to the list of things to cope with. As has been highlighted, testing is an incredibly emotional journey – you will need support during this process. Do not face it alone if you don’t have to. This is hopefully a time for the family to all get behind the person testing and support each other.

For people testing who have siblings either at-risk, already tested or symptomatic, testing can be an even tougher experience. Imagine testing negative if one of your siblings had already tested positive – how do you tell them your news? This is often called ‘sibling guilt’ and it can be uncomfortable and difficult to handle. But it does not have to be, as one family highlights:

‘Telling my siblings was emotionally complex. I desperately wished they could have had the same result. It seemed so unfair how the disease picks and chooses whom it will take, and whom it will leave behind to witness the devastating effects. But as I rang each one of my wonderful brothers, they were thrilled and cheered down the phone.’ Jen, as she tells her brothers (both of whom are positive) she has tested negative.

Support is the key, whatever the results. Talk about the worries you have with your siblings, express your concerns about how the family will react to your results before you get them – try to prepare as a family.

You shouldn’t feel that you need your family’s permission or support to get tested – remember, it is your choice. Having contact with HD specialists, advocacy organizations, and other people that have been through testing can be an excellent source of support during the testing process. For example, you may find support from your local advocacy organization or online support groups like HDYO’s Facebook Group or the many other online forums. There, you will find many people going through similar concerns who will be able to share experiences. Talking to others in similar situations can be helpful. You can also reach out to HD Genetics and we can connect you to the proper resources for you.


Getting Your Genetic Results

Positive or negative (or in the gray area), the day you receive your result may feel like the most surreal day of your life. It is important that you take the time you need in order to accept your result. Acceptance takes time. Different results will bring with them different emotions and different hurdles in the future. Testing positive raises some more obvious issues, but testing negative also has its complications. Both are discussed in the sections below.


Testing Positive for Huntington’s Disease

Testing positive for Huntington’s disease can be a traumatic experience – one that can really knock you off your feet. It may take you a while to feel like yourself again. These things take time and it is important to not expect too much from yourself after your result. As was highlighted in the main testing section, accepting your results can only be done gradually over time.

‘When I tested positive I must have spent the next 6 months feeling down and sorry for myself – I was not very productive during that time! But I was always looking to move forward and accept my results, and gradually I started to make progress. Now, 3 years later, I am very happy with my life and have accepted my results.’ Ben

It is important to remember that you are able to have follow-up appointments with your genetic counselor anytime you want to discuss your result and how you feel. HD Genetics’ services do not end with your results appointment, so please reach out anytime after your results if we can help.This can be very useful and the counselor will be happy to go through any issues that are on your mind.

Consider who you are going to inform about your results. Telling friends or work colleagues is really only something you can decide. The lack of understanding about the disease can cause issues: Will they understand? Will it affect how people view you at work?

Once you have had time to get used to the result, you can use the fact you have tested positive as the reason/motivation to do the things in life that you have always wanted to do. Why not go traveling or change your career, begin a new fitness regime – have a fresh new start in life! Testing positive can be great motivation to get out there and experience life. 

Another important issue to remember is that testing positive may change the way you see things in life. For instance, if you have a family member who is symptomatic with Huntington’s disease, you may find that, because you have tested positive, it is hard for you to witness that person’s progression. As one man explains:

‘After I tested positive it became really hard for me to care for my father who had Huntington’s disease. I kept looking at him with his symptoms, and thinking “that will be me in 20 years”. It was really difficult to deal with at first, but after a while I settled down again and things got back to normal.’ John

Time really does help. You may not feel like you have a lot of it right now, but rest assured you still have plenty of time to enjoy life. Research into Huntington’s disease is progressing really quickly and there is very much real hope for the future. You may want to help by participating in research yourself; it can be a very rewarding experience and many feel they are being productive by participating in research studies. Reach out to the HD Genetics team if you are interested in participating in research and we can connect you to clinics that conduct research. 

There are many good days yet to experience, and yes, you will have your bad days too (who doesn’t?). Try to stay positive and keep moving forward and you will continue to achieve in life. Remember that you have always had the expanded gene; the only difference is that now you know. You have the advantage of knowledge about your future. Testing positive might just be the motivation you needed to achieve great things and to lead a life to be proud of.

Testing Negative For Huntington’s Disease

Testing negative is generally seen as the ‘good result’. People may expect you to be happy, delighted, or ecstatic. However, testing negative does not mean somebody is completely free of Huntington’s disease from their lives. Chances are you still have family members who are either symptomatic, at-risk or gene positive.

One of the biggest issues for those that test negative is a feeling of guilt. So many people feel huge amounts of guilt for receiving a negative result – you may be feeling that way too. It is important that you discuss these feelings with your family and friends, and be open and honest. You have every right to feel what you feel.

‘I received a negative result and the biggest feeling I felt was a huge amount of guilt. Some people may think I was selfish not showing that I was happy with this result, but knowing many people who tested positive and having an untested brother, all I could feel was sheer guilt. It is important to speak to friends and family about the result, my father encouraged me to celebrate the negative result, however I felt I could not do that. I suffered from receiving a negative result for months as personally it was a huge mental obstacle for me. It wasn’t until I sought deeper advice that I understood that receiving a negative result is nothing to be ashamed about. It is still important however to continue being a part of the Huntington’s disease community and supporting others dealing with the struggles of the disease.’ Lisa

Some people feel like a part of them has been taken away when they test negative – as if Huntington’s disease was a part of their identity, and now it has gone they are unsure what they want to do in life. Feeling this way may cause issues. For instance, one of the main things, for so many years, a person has in common with their family is Huntington’s disease, so if someone tests negative and now knows they won’t have the condition, they may feel a form of separation from their family – like they have lost that connection.

It is very important that you discuss any issues you are worried about. You are entitled to have follow-up appointments with your genetic counselor to talk about your result and any issues you have. As was highlighted before, discuss your feelings with your family as well – they may not realize how you are feeling inside. 

‘Testing negative was without a doubt, the most incredible news I’ve ever received. The day I received my results was surreal – and a gigantic emotional roller-coaster. What started as the happiest day of my life turned into the hardest night…I was prepared to feel some guilt, but wasn’t ready to be completely overwhelmed. I knew logically that I shouldn’t feel guilty, but it hit me…HARD! I couldn’t get over the fact that I was – for lack of a better term – ‘safe’…and the guilt that came with that realization was incredible. I felt so horrible knowing that so many people I love aren’t as lucky as I am, or their future was still up in the air. The fear of telling other people sent me into panic attacks and it took everything I had just to keep breathing. Thankfully, I have people in my life who were more supportive than ever, and gave me the exact message I needed to hear: ‘That guilt will become a good thing and make you more inspired than ever to make a difference’. Slowly but surely I began to feel like myself again…and even though I still feel guilty some days, I just take it one day at a time and try to keep doing everything I can to contribute to the fight against Huntington’s disease!’ Elaine

Even though you may have tested negative, you can still help with the search for better treatments or get involved to support the HD community. There are research studies that want and need people who have tested negative. You can participate in these and help not only your family, but others suffering with Huntington’s disease too. Reach out to the HD Genetics team if you are interested in participating in research and we can walk you through all the available options to consider.

Testing In the Gray Area For Huntington’s Disease

Testing for Huntington’s disease is often thought to be a “black or white” process, meaning testing tells you that you either will or won’t develop symptoms of Huntington’s disease. However, it is slightly more complicated than that. If testing reveals you have 40 or more CAG’s in one of the copies of your Huntington gene, you are certain to develop symptoms of Huntington’s disease. If testing reveals that you have less than 27 CAG’s, you are not at risk of Huntington’s disease and your children are not either. The “gray area,” CAG 27-39, can bring mixed emotions. The gray area can also be referred to as having an “intermediate” or “reduced penetrance” allele,  meaning it’s not large enough to predict Huntington’s disease with certainty, but it’s also not small enough to rule out Huntington’s disease from the individual or their biological children. There are two categories that are important to know when we use the terms “gray area” or “gray zone” allele.

27-35 CAG repeats (aka “Intermediate” or “Mutable Normal”)
Almost certainly will not develop Huntington’s disease but small risk to children.

36-39 CAG repeats (aka “Reduced Penetrance”)
May develop symptoms at an older age. 50% risk to each child.

For people who have a CAG of 27-35, we know that it is very unlikely that the individual will develop HD symptoms, but there is still some risk of passing a higher CAG repeat expansion to their child that could then be in the range to develop HD symptoms. We’ve seen literature that the risk of passing to a child in this range is about 2-5%. It’s a small risk, but still a reality. Making sure your partner is aware of this risk is very important so the two of you can have a conversation about what is best for you both. Some people may think that this risk is small enough to not try any type of alternative pregnancy options (like PGD/IVF) and some might prefer zero risk of passing along HD and seek an alternative method to having children. This choice is 100% up to you and your partner.

For people who have a CAG of 36-39, we unfortunately don’t yet have a good way to predict if they will or will not develop HD symptoms in their life. The science community knows a lot about HD, but we still don’t know everything right now. This result can be received with a bit of confusion. On one hand your CAG is lower, so the age of onset is most likely later in life. However, this is not a certainty. Most people choose to pursue testing because they are ready to know if their genetics are either heads or tails on that flip of a coin, but aren’t totally prepared for when the coin lands on its side. The best way to prepare for a result in this range is to be educated that this is a possibility and understand what it entails. By having the knowledge of a gray area result you prepare your mind for that chance. 

No matter if you test positive, negative or with one of the gray area ranges – the genetic testing process can be an emotional process. The Huntington’s disease community has a plethora of supportive resources and programs available to help you before, during, and after testing. At HD Genetics we are here to help you however we can with our HD-dedicated staff, our network, and knowledge of the HD community landscape. If you are interested in pursuing genetic testing, you can start the HD Genetics process by filling out the intake form. Then, we can guide you through our process or help you find another genetic testing option that fits your needs.

End of section

A Reminder About Information on this Webpage:

The language on this webpage was provided with permission from the Huntington’s Disease Youth Organization (www.HDYO.org). HD Genetics made appropriate edits and updates to content in January 2023 and published Jan 9, 2023. The original content can be found on HDYO’s pages (What is Huntington’s Disease, Genetic Testing and Being At-Risk).

The content above is meant as educational content and not medical advice. Please reach out to the HD Genetics team or your healthcare professional if you have questions or concerns.

If you have any comments, suggestions or edits, please reach out to the HD Genetics team. We very much welcome your input!

Update Jan 10, 2023.